I just got my MtDNA results from FamilyTreeDNA.

I am haplogroup C, which supposedly "is found in eastern Eurasia and throughout the Americas. This haplogroup was present in the populations that initially colonized the pre-Columbian Americas, and dates to at least 40,000 years ago. Future work will resolve the issue of how many distinct colonization events there were in the original peopling of the Americas, and the role of individuals bearing haplogroup C." (Description used without written permission).

Eastern Eurasia. No wonder people from there mistake me for Filipino or Thai. This happens frequently. I do have an Asian cast to my eyes.

They also sent a map showing the migration of haplogroup C from eastern Africa across Asia, over the Bering Straight, down Alaska and Canada, and then to North, Central and South America.

Maybe when I go to Arizona, and they ask for my papers, I can show them this to prove I didn't hop the fence yesterday, and ask them to show me theirs. Forty thousand years! I guess I am as "American" as anybody can get. I knew I was Native American--all I have to do is look in the mirror---and my mother's people-- the Piro-Manso-Tewa- have been in some pueblos in New Mexico that have been continually occupied for over a thousand years, but they have really been there 40,000 years? How do they figure that? Wow!

They also sent a graph of "HVR1 Differences from rCRS" (mutations?): 1609C, 16176T, 1628T, 1629C, 16325C, 16327T, and 16519C. I also clicked on "Show All Positions" and I got a very long string of the same thing, but the letters included were A, T, C, and G. Are those haplogroups? What are they?

I am not a total dummy, but this DNA stuff has me in a tizzy. What are mutations? What are the differences? Should I care? I tried looking at their tutorials, but I ended up feeling like an imbecile, not understanding a thing. Their website also is very difficult to maneuver. I couldn't find my results until I clicked on dozens of titles.

They also sent a list of "matches". Some have Anglo surnames, but their "most distant known female ancestor" are all from New Mexico. The surnames of these ancestors are not in my lines, but they are all common to New Mexico. I guess that just means that no one with my particular surnames submitted their MtDNA.

Thank you in advance for any help in understanding this,

Emilie
Port Orchard, WA

Comment

Hello Emilie,

The colonization of the Americas happened about close to 15,000-18,000
years ago and there were 15 founding mtDNA lineages according to the two
following articles.

http://www.sciencedaily.com/releases/2011/10/111020145054.htm

http://www.sciencedaily.com/releases/2010/06/100628170926.htm

Native American Y-DNA is also an interesting subject. Hopefully more
studies will be realized with those groups in the coming years. In the
following page they compare Sioux, Chippewa, Pima, Tarahumara, Nahua, and
Otomí, and Qechua speakers.

http://dienekes.blogspot.com/2012/05/y-chromosome-diversity-in-native.h…

Your mtDNA haplogroup started 40,000 years ago and they determine that by a
calculation of mutation rates. Your ancestor that had that first mutation
lived in Asia and her descendants didn't cross the Bering Strait until
15,000-18,000 years ago. A mutation is the sudden change in genes or
chromosomes between an organism or being and an offspring. This is what
caused evolution. The beings with the mutations that were better suited to
changes in the environment were the ones that survived. Mutations can be
seen in the DNA because of sequences that change. These sequences are
represented by the letters A, T, C, and G which stand for four chemical
bases: adenine (A), guanine (G), cytosine (C), and thymine (T). The DNA
strands with a string of letters like
this:ATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAG Certain areas of the
DNA have
certain sequences and when there is a difference between one person and
another that is the mutation they are speaking of.

I don't think mtDNA changes as often as Y-DNA which is why it is harder to
find matches with people with the same surname apart from the fact that the
population size has to be fairly large and there have to be enough people
willing to test. Unfortunately there are too many people unwilling to test
in all segments which slows the discovery process. We need more people
willing to test and share the data. I think their inability to understand
what can be derived from DNA or what it means keeps them from doing this.
It is very sad really.

Saludos
Armando

On Mon, Jul 2, 2012 at 9:26 PM, Emilie Garcia wrote:

>
> I just got my MtDNA results from FamilyTreeDNA.
>
> I am haplogroup C, which supposedly "is found in eastern Eurasia and
> throughout the Americas. This haplogroup was present in the populations
> that initially colonized the pre-Columbian Americas, and dates to at least
> 40,000 years ago. Future work will resolve the issue of how many distinct
> colonization events there were in the original peopling of the Americas,
> and the role of individuals bearing haplogroup C." (Description used
> without written permission).
>
> Eastern Eurasia. No wonder people from there mistake me for Filipino or
> Thai. This happens frequently. I do have an Asian cast to my eyes.
>
> They also sent a map showing the migration of haplogroup C from eastern
> Africa across Asia, over the Bering Straight, down Alaska and Canada, and
> then to North, Central and South America.
>
> Maybe when I go to Arizona, and they ask for my papers, I can show them
> this to prove I didn't hop the fence yesterday, and ask them to show me
> theirs. Forty thousand years! I guess I am as "American" as anybody can
> get. I knew I was Native American--all I have to do is look in the
> mirror---and my mother's people-- the Piro-Manso-Tewa- have been in some
> pueblos in New Mexico that have been continually occupied for over a
> thousand years, but they have really been there 40,000 years? How do they
> figure that? Wow!
>
> They also sent a graph of "HVR1 Differences from rCRS" (mutations?):
> 1609C, 16176T, 1628T, 1629C, 16325C, 16327T, and 16519C. I also clicked
> on "Show All Positions" and I got a very long string of the same thing, but
> the letters included were A, T, C, and G. Are those haplogroups? What are
> they?
>
> I am not a total dummy, but this DNA stuff has me in a tizzy. What are
> mutations? What are the differences? Should I care? I tried looking at
> their tutorials, but I ended up feeling like an imbecile, not understanding
> a thing. Their website also is very difficult to maneuver. I couldn't
> find my results until I clicked on dozens of titles.
>
> They also sent a list of "matches". Some have Anglo surnames, but their
> "most distant known female ancestor" are all from New Mexico. The surnames
> of these ancestors are not in my lines, but they are all common to New
> Mexico. I guess that just means that no one with my particular surnames
> submitted their MtDNA.
>
> Thank you in advance for any help in understanding this,
>
> Emilie
> Port Orchard, WA

Comment

Juan Francisco Sanchez Alvarez

Hi, I received my results last year and I was Haplogroup A, but on last month I received the results of family finder and the results were:

57.04% Europe Western Europe (French, Spanish)
29.62% Central American Native American (Mayan)
8.25 % Midle East Mozabite, Palestinian, Jewish,Bedouin
5.09 % East Asia (Siberian) Yakut

My Y DNA is R1b western europe.

With family finder I check that a part of native american with Mtdna haplogropu A came from Siberia as you can see. Family finder put mayan for all native american of Mexico, because until now they do not have for huichol, azteca, caxcan, olmeca, seri, tarahumara, etc dna.

My matches are just two persons one from Mexico and one from New Mexico.

My family came from Tlaltenango, Zacatecas

My maternal lineage : Juana de Jesus ab 1720 Tlaltenango
My paternal lineage : Manuel Sanchez Castellanos ab 1559 Sevilla, Spain

Comment

Armando,

Thanks for your clear explanation of DNA for me. I need someone that can come down to my level of understanding. When it comes to math, science, etc. I am like a not-so-smart 2nd grader.

I can see that I misunderstood the time that Haplogroup has been in the Americas. I kind of thought that was unusual, since mostly I have heard that Native Americans populated the Americas 10,000 years ago only.

I have a question still about the mutations. The A, T. C. and G, are those only for my haplogroup C or does everyone have those letters? Also does haplogroup C mean that my chemical base is cytocine---is that how they came up with the letters for the various haplogroups, the chemical bases?

Yes, you are right about people hesitating to provide their DNA for research--the fact that the science of it and terminology seem daunting. That was my reason---I couldn't understand "subclades" etc when people on Nuestros Ranchos started talking about it. In fact, had I not joined Nuestros Ranchos, I wouldn't even have been aware of DNA testing for genealogical purposes. Now there are shows on TV that kind of help inform people, but some people refuse for reasons unknown to participate in DNA testing. I am sure some whites don't like the discovery of Africans in their ancestry.

I know from my researching the records in Zacatecas that my father had mulatto blood as well as Basque and very little indio. Mostly the records on his male side say espanol. I have found nothing on his mother's side. He told me he was a mestizo. So does that mean that since my DNA follows only my female ancestors on my maternal side, that I will never know if I have mulato or Basque DNA?

Your explanation of mutations and that they occur from one person to another, and not that it occurs in the same person helped me a lot in understanding. (See, I told you my understanding is almost less than grade-school). I'm an artist and intuitive, not what you would call "rational".

I too am interested in Y-DNA though I will never know my father's (from Zacatecas) since he had no brothers and his uncles and male cousins are long gone and I don't know the younger generations. I only have a sister. I wanted to know from the Apaches what their DNA is, but they say that their elders do not want them to be studied that way, nor will they share their family trees; they say they are all "equal" and that family trees only serve to find out who is more elite than others. They also say descendancy is "matrilineal"? I thought that the BIA required that they be tested, but I guess they force them to do that---they fear being taken off the rolls and lose benefits if they don't have a certain "quantum" of Native blood?

I want to know about the Apaches because so many of my male cousins were never taught about their tribal history and think they are Apache, but I know they are not. We are Piro-Manso-Tewa, Pueblo tribes going back to the days of Onate, though the last person who knew the language and tribal history was my great-grandfather who was killed in 1900. My 98 year old Auntie in New Mexico knows the real story. All of our male ancestors fought the Apaches, and I have military records to show they belonged to local militias and were Army scouts who battled the Apaches before and after the Civil War. During the days of the Royal Army they served in the Presidios, again to protect the routes and people from "los indios barbaros".

I hope you don't mind my asking so many questions. Thank you again,

Emilie
Port Orchard, WA

-----------------------------------------------------------

> Date: Tue, 3 Jul 2012 22:44:37 -0500
> From: fandemma@gmail.com
> To: announce@nuestrosranchos.org
> Subject: Re: [Nuestros Ranchos] My MtDNA Results
>
> Hello Emilie,
>
> The colonization of the Americas happened about close to 15,000-18,000
> years ago and there were 15 founding mtDNA lineages according to the two
> following articles.
>
> http://www.sciencedaily.com/releases/2011/10/111020145054.htm
>
> http://www.sciencedaily.com/releases/2010/06/100628170926.htm
>
>
> Native American Y-DNA is also an interesting subject. Hopefully more
> studies will be realized with those groups in the coming years. In the
> following page they compare Sioux, Chippewa, Pima, Tarahumara, Nahua, and
> Otomí, and Qechua speakers.
>
> http://dienekes.blogspot.com/2012/05/y-chromosome-diversity-in-native.h…
>
>
> Your mtDNA haplogroup started 40,000 years ago and they determine that by a
> calculation of mutation rates. Your ancestor that had that first mutation
> lived in Asia and her descendants didn't cross the Bering Strait until
> 15,000-18,000 years ago. A mutation is the sudden change in genes or
> chromosomes between an organism or being and an offspring. This is what
> caused evolution. The beings with the mutations that were better suited to
> changes in the environment were the ones that survived. Mutations can be
> seen in the DNA because of sequences that change. These sequences are
> represented by the letters A, T, C, and G which stand for four chemical
> bases: adenine (A), guanine (G), cytosine (C), and thymine (T). The DNA
> strands with a string of letters like
> this:ATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAG Certain areas of the
> DNA have
> certain sequences and when there is a difference between one person and
> another that is the mutation they are speaking of.
>
> I don't think mtDNA changes as often as Y-DNA which is why it is harder to
> find matches with people with the same surname apart from the fact that the
> population size has to be fairly large and there have to be enough people
> willing to test. Unfortunately there are too many people unwilling to test
> in all segments which slows the discovery process. We need more people
> willing to test and share the data. I think their inability to understand
> what can be derived from DNA or what it means keeps them from doing this.
> It is very sad really.
>
> Saludos
> Armando
>
> On Mon, Jul 2, 2012 at 9:26 PM, Emilie Garcia wrote:
>
> >
> > I just got my MtDNA results from FamilyTreeDNA.
> >
> > I am haplogroup C, which supposedly "is found in eastern Eurasia and
> > throughout the Americas. This haplogroup was present in the populations
> > that initially colonized the pre-Columbian Americas, and dates to at least
> > 40,000 years ago. Future work will resolve the issue of how many distinct
> > colonization events there were in the original peopling of the Americas,
> > and the role of individuals bearing haplogroup C." (Description used
> > without written permission).
> >
> > Eastern Eurasia. No wonder people from there mistake me for Filipino or
> > Thai. This happens frequently. I do have an Asian cast to my eyes.
> >
> > They also sent a map showing the migration of haplogroup C from eastern
> > Africa across Asia, over the Bering Straight, down Alaska and Canada, and
> > then to North, Central and South America.
> >
> > Maybe when I go to Arizona, and they ask for my papers, I can show them
> > this to prove I didn't hop the fence yesterday, and ask them to show me
> > theirs. Forty thousand years! I guess I am as "American" as anybody can
> > get. I knew I was Native American--all I have to do is look in the
> > mirror---and my mother's people-- the Piro-Manso-Tewa- have been in some
> > pueblos in New Mexico that have been continually occupied for over a
> > thousand years, but they have really been there 40,000 years? How do they
> > figure that? Wow!
> >
> > They also sent a graph of "HVR1 Differences from rCRS" (mutations?):
> > 1609C, 16176T, 1628T, 1629C, 16325C, 16327T, and 16519C. I also clicked
> > on "Show All Positions" and I got a very long string of the same thing, but
> > the letters included were A, T, C, and G. Are those haplogroups? What are
> > they?
> >
> > I am not a total dummy, but this DNA stuff has me in a tizzy. What are
> > mutations? What are the differences? Should I care? I tried looking at
> > their tutorials, but I ended up feeling like an imbecile, not understanding
> > a thing. Their website also is very difficult to maneuver. I couldn't
> > find my results until I clicked on dozens of titles.
> >
> > They also sent a list of "matches". Some have Anglo surnames, but their
> > "most distant known female ancestor" are all from New Mexico. The surnames
> > of these ancestors are not in my lines, but they are all common to New
> > Mexico. I guess that just means that no one with my particular surnames
> > submitted their MtDNA.
> >
> > Thank you in advance for any help in understanding this,
> >
> > Emilie
> > Port Orchard, WA
> > -- -- -- -- -- -- -- -- -- -- -- -- --
> > Nuestros Ranchos Announce Mailing List
> >
> > To post, send email to:
> > announce(at)nuestrosranchos.org
> >
> > To change your subscription, log on to:
> > http://www.nuestrosranchos.org
> >

Comment

Everybody has A, T. C. and G. They are the nucleobases of DNA of all living
things. The letter assigned to each haplogroup has no relation to the
nucleobases. The letters for the haplogroups were assigned as they first
identified the haplogroups, most likely in alphabetical order.

In order to find out more about your DNA you can do a Family Finder test
like the one Juan Francisco Sanchez Alvarez kindly published yesterday.
However, as you can see Western Europeans are clumped together as one
group. There is no distinction between region so the Basque would be
grouped into that one. The Middle Easterners are grouped together and so
on. So you will only get generalized results and not results as specific as
Y-DNA can be. For example, my subgroup or subclade within the R1b
haplogroup has it's highest frequency in Northeast Spain and Southwest
France and first came about 4,200 years ago. The Basque Country is in
Northeast Spain which is where my great-grandfather was from and since his
DNA matches the area then his ancestors most likely had been there at least
4,000 and up to 5,000 years before him. I would not be able to get that
info from a Family Finder test. This is where having our distant cousins
doing Y-DNA tests for our different lines could help us out and it could be
more valuable than the Family Finder tests, although if enough people did
those we could find more info on a few other things as well. In your case I
recommend you get the Family Finder test even though you won't have
specific answers to some questions.

The Y-DNA subclades M65, Z196, and M153 are the ones that are more
prevalent within the Basque country but there are other subclades within
the Basque country so even if you could get the Y-DNA of your distant
cousins you wouldn't necessarily be able to say for a fact if they were
Basque or not. Not all is lost though. What is the surname and date of the
person you think was Basque? We might be able to find someone from the same
line that has tested or is willing to test.

It's unfortunate that the Apache don't want to test. Some things will
always remain a mystery even if there are/were ways to know the truth.

Of course I don't mind you asking the questions.

Saludos,
Armando

On Thu, Jul 5, 2012 at 1:18 PM, Emilie Garcia wrote:

>
> Armando,
>
> Thanks for your clear explanation of DNA for me. I need someone that can
> come down to my level of understanding. When it comes to math, science,
> etc. I am like a not-so-smart 2nd grader.
>
> I can see that I misunderstood the time that Haplogroup has been in the
> Americas. I kind of thought that was unusual, since mostly I have heard
> that Native Americans populated the Americas 10,000 years ago only.
>
> I have a question still about the mutations. The A, T. C. and G, are
> those only for my haplogroup C or does everyone have those letters? Also
> does haplogroup C mean that my chemical base is cytocine---is that how they
> came up with the letters for the various haplogroups, the chemical bases?
>
> Yes, you are right about people hesitating to provide their DNA for
> research--the fact that the science of it and terminology seem daunting.
> That was my reason---I couldn't understand "subclades" etc when people on
> Nuestros Ranchos started talking about it. In fact, had I not joined
> Nuestros Ranchos, I wouldn't even have been aware of DNA testing for
> genealogical purposes. Now there are shows on TV that kind of help inform
> people, but some people refuse for reasons unknown to participate in DNA
> testing. I am sure some whites don't like the discovery of Africans in
> their ancestry.
>
> I know from my researching the records in Zacatecas that my father had
> mulatto blood as well as Basque and very little indio. Mostly the records
> on his male side say espanol. I have found nothing on his mother's side.
> He told me he was a mestizo. So does that mean that since my DNA follows
> only my female ancestors on my maternal side, that I will never know if I
> have mulato or Basque DNA?
>
> Your explanation of mutations and that they occur from one person to
> another, and not that it occurs in the same person helped me a lot in
> understanding. (See, I told you my understanding is almost less than
> grade-school). I'm an artist and intuitive, not what you would call
> "rational".
>
> I too am interested in Y-DNA though I will never know my father's (from
> Zacatecas) since he had no brothers and his uncles and male cousins are
> long gone and I don't know the younger generations. I only have a sister.
> I wanted to know from the Apaches what their DNA is, but they say that
> their elders do not want them to be studied that way, nor will they share
> their family trees; they say they are all "equal" and that family trees
> only serve to find out who is more elite than others. They also say
> descendancy is "matrilineal"? I thought that the BIA required that they be
> tested, but I guess they force them to do that---they fear being taken off
> the rolls and lose benefits if they don't have a certain "quantum" of
> Native blood?
>
> I want to know about the Apaches because so many of my male cousins were
> never taught about their tribal history and think they are Apache, but I
> know they are not. We are Piro-Manso-Tewa, Pueblo tribes going back to the
> days of Onate, though the last person who knew the language and tribal
> history was my great-grandfather who was killed in 1900. My 98 year old
> Auntie in New Mexico knows the real story. All of our male ancestors
> fought the Apaches, and I have military records to show they belonged to
> local militias and were Army scouts who battled the Apaches before and
> after the Civil War. During the days of the Royal Army they served in the
> Presidios, again to protect the routes and people from "los indios
> barbaros".
>
> I hope you don't mind my asking so many questions. Thank you again,
>
> Emilie
> Port Orchard, WA
>

> -----------------------------------------------------------
>

Comment

Emilie,

It is interesting to see you also got Haplogroup C. I notice not many members here have that MtDNA Haplogroup.

I also have Haplogroup C, and I noticed many in the same Haplogroup do have their ancestral origins in New Mexico.

Comment

>> Anyway my too long of point is I don't think it matters where you go you just need to be aware that what comes back may look surprising so you may need to do some additional research to make sense of it.

Applause!!!

Very well said. Our story was not inspired by DNA results, but rather the appearance of a Mongolian birthmark on our first-born son. Both my husband and I were doing some head scratching. Our families were all speculating about the Mongolian immigration, indigenous lineage, etc. Research has now shown us that my husband's great grandfather immigrated to Mexico from China. Now I look forward to some fun when we finally get our DNA testing done.

In reply to by bbbunny

Comment

just wanted to share our head scratching moment too when we got back my Mothers paternal Gutierrez line that I had researched back to Michoacan in abt 1660.. the DNA said haplogroup N.. Siberia, Finland and Russia.. then I found the the Sami tribe in Finland has exfoliation glaucoma that is  a genetic condition passed through families.. in my maternal like we almost all have exfoliation glaucoma.. could be just a co incidence but was interesting.  I also got an e-mail from a person in the states who said her family paternal line had immegrated to the States from Finland in 1850.. we were a genetic match!  we both had to laugh.. what else can you do! I did forget to ask if they have exfoliation glaucoma too.. oh well..
Linda in B.C.

________________________________
From: That Danged Wabbit
To: announce@lists.nuestrosranchos.org
Sent: Wednesday, August 29, 2012 11:35 PM
Subject: Re: [Nuestros Ranchos] DNA results

>> Anyway my too long of point is I don't think it matters where you go you just need to be aware that what comes back may look surprising so you may need to do some additional research to make sense of it.

Applause!!!

Very well said.  Our story was not inspired by DNA results, but rather the appearance of a Mongolian birthmark on our first-born son.  Both my husband and I were doing some head scratching.  Our families were all speculating about the Mongolian immigration, indigenous lineage, etc.  Research has now shown us that my husband's great grandfather immigrated to Mexico from China.  Now I look forward to some fun when we finally get our DNA testing done.

Comment

My sister told me that she had a couple of teeth that were scooped shape in
the back, and that she had read this indicated Mongolian roots. Has anyone
heard of this?
I myself have two scooped shape teeth. One on each side of the front teeth.

What was the Mongolian birth mark?

-----Original Message-----
From: announce-bounces@lists.nuestrosranchos.org
[mailto:announce-bounces@lists.nuestrosranchos.org] On Behalf Of That Danged
Wabbit
Sent: Thursday, August 30, 2012 1:35 AM
To: announce@lists.nuestrosranchos.org
Subject: Re: [Nuestros Ranchos] DNA results

>> Anyway my too long of point is I don't think it matters where you go you
just need to be aware that what comes back may look surprising so you may
need to do some additional research to make sense of it.

Applause!!!

Very well said. Our story was not inspired by DNA results, but rather the
appearance of a Mongolian birthmark on our first-born son. Both my husband
and I were doing some head scratching. Our families were all speculating
about the Mongolian immigration, indigenous lineage, etc. Research has now
shown us that my husband's great grandfather immigrated to Mexico from
China. Now I look forward to some fun when we finally get our DNA testing
done.